Archives

  • 2019-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • U0126 Ordered from IDT mouseprimerdepot nci nih gov br

    2020-08-30

    Ordered from IDT mouseprimerdepot.nci.nih.gov
    RORc REV: TGCAGGAGTAGGCCACATTACA Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL17F FW: CCTCCCCTGGAGGATAACAC Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL17F REV: CATGGGGAACTGGAGCGGTT Ordered from IDT mouseprimerdepot.nci.nih.gov
    Ptgs2 (COX2) FW: TGAGCAACTATTCCAAACCAGC Ordered from IDT mouseprimerdepot.nci.nih.gov
    Ptgs2 (COX2) REV: GCACGTAGTCTTCGATCACTATC Ordered from IDT mouseprimerdepot.nci.nih.gov
    16S bacterial RNA FW: AGAGTTTGATCMTGGCTCAG Ordered from IDT
    16S bacterial RNA REV: TACGGYTACCTTGTTACGACTT Ordered from IDT
    SFB FW: GACGCTGAGGCATGAGAGCAT Ordered from IDT
    SFB REV: GACGGCACGGATTGTTATTCA Ordered from IDT
    E.Coli FW: U0126 CATGCCGCGTGTATGAAGAA Ordered from IDT
    E.Coli REV: CGGGTAACGTCAATGAGCAAA Ordered from IDT
    Enterobacteria FW: GTGCCAGCMGCCGCGGTAA Ordered from IDT
    Enterobacteria REV: GCCTCAAGGGCACAACCTCCAAG Ordered from IDT
    Clostridia FW: CGCATAACGTTGAAAGATGG Ordered from IDT
    Clostridia REV: CCTTGGTAGGCCGTTACCC Ordered from IDT
    Bacteroides FW: GGTTCTGAGAGGAGGTCCC Ordered from IDT
    Bacteroides REV: GCTGGCTCCCGTAGGAGT Ordered from IDT
    (Continued on next page)
    Continued
    REAGENT or RESOURCE SOURCE IDENTIFIER
    S100A8 FW Ordered from IDT mouseprimerdepot.nci.nih.gov
    CCAATTCTCTGAACAAGTTTTCG
    S100A8 REV Ordered from IDT mouseprimerdepot.nci.nih.gov
    TCACCATGCCCTCTACAAGA
    S100A9 FW: GTCCAGGTCCTCCATGATGT Ordered from IDT mouseprimerdepot.nci.nih.gov
    S100A9 REV: GAAGGAAGGACACCCTGACA Ordered from IDT mouseprimerdepot.nci.nih.gov
    Reg3b FW: ACTCCCTGAAGAATATACCCTCC Ordered from IDT mouseprimerdepot.nci.nih.gov
    Reg3b REV: CGCTATTGAGCACAGATACGAG Ordered from IDT mouseprimerdepot.nci.nih.gov
    Reg3g FW: TGCTGCTCTCCTGCCTGATG Ordered from IDT mouseprimerdepot.nci.nih.gov
    Reg3g REV: ATAGGAGCCATAGGCACGGG Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL33 FW: TCCAACTCCAAGATTTCCCCG Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL33 REV: CATGCAGTAGACATGGCAGAA Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL18 FW: TCCTTGAAGTTGACGCAAGA Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL18 REV: TCCAGCATCAGGACAAAGAA Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL1F10 FW: TGTCTGAATCAGGGTCTCCC Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL1F10 REV: TGAAGACCAGACACTCCCAA Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL36a FW: GGCTTTTACAGGTTCCTTTTTG Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL36a REV: GATGAGCTGCCTGTTCTGC Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL36g FW: GTCCGGGTGTGGTAAAACAG Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL36g REV: GGACACCCTACTTTGCTGCT Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL36b FW: AGAGTATTCAAATGTGGGAACCG Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL36b REV: GACCCATACCATCTGTTGTGAG Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL36Ra FW: GCAGCTGGTTATTGTGCAGAT Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL36Ra REV: TGGAGCTCATGATGGTTCTG Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL36R (IL1RL2) FW: TCCCCGCTTTAATCTCTTCA Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL36R (IL1RL2) REV: ATCGGGCAGTCTGAATTGTC Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL18bp FW: TCTCCAGCAGTCCCAACTAAGC Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL18bp REV: AGGCAGTACAGGACAAGGTCAG Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL1R exon5 FW: TGGAAGTCTTGTGTGCCCTT Ordered from IDT This paper
    IL1R exon5 REV: ACTCCGAAGAAGCTCACGTT
    Ordered from IDT
    This paper
    Software and Algorithms
    Flow Jo 9.7.6 FlowJo LLC https://www.flowjo.com/
    Vectra 3.0 Perkin Elmer www.perkinelmer.com/product/
    Imaris Bitplane http://www.bitplane.com/
    UCHIME
    https://www.drive5.com/
    usearch/manual/uchime_algo.html
    http://qiime.org/
    GraphPad
    https://www.graphpad.com/
    Other
    Poly-L-Lysine Cellware 12mm round Coverslips Corning Cat. #354085
    U bottom 96-well tissue culture plate Olympus Cat # 25-221
    CONTACT FOR REAGENT AND RESOURCE SHARING
    Further information and requests for reagents should be directed to and will be fulfilled by the Lead Contact, S.I. Grivennikov, email:
    [email protected]
    EXPERIMENTAL MODELS
    Mice
    Using Il1r1f/f conditional allele (Bruttger et al., 2015), we generated a panel of mice in which IL-1R1 expression was ablated in colonic epithelial and cancer celIs. Il1r1f/f mice were crossed to different Cre-recombinases to get cell-specific deletion of Il1r1 gene, including CD4Cre, CX3CR1Cre, CD11bCre, LysMCre and Ly6GCre. Cre-mediated recombination of these sites resulted in a frame-shift and early termination of protein translation in exon 5. CX3CR1Cre, CD4Cre, Il17aGFP, RorcGFP and LysMCre mice were obtained from Jackson Laboratory. Apcf/f, CDX2Cre (CPC) and CDX2ERT mice have been provided by E. Fearon. Ly6GCre (‘catchup’’) mice were from Matthias Gunzer (Hasenberg et al., 2015). For further information and MGI numbers identifying aforementioned mouse strains please see Key Resources Table.